SKP2 (Ab-64) Antibody
- Known as:
- SKP2 (Antibody-64) Antibody
- Catalog number:
- 21700
- Product Quantity:
- USD
- Category:
- -
- Supplier:
- Signalway
- Gene target:
- SKP2 (Ab-64) Antibody
Related genes to: SKP2 (Ab-64) Antibody
- Gene:
- SKP2 NIH gene
- Name:
- S-phase kinase associated protein 2
- Previous symbol:
- -
- Synonyms:
- FBXL1, FBL1, p45
- Chromosome:
- 5p13.2
- Locus Type:
- gene with protein product
- Date approved:
- 1995-12-18
- Date modifiied:
- 2016-10-05
Related products to: SKP2 (Ab-64) Antibody
Related articles to: SKP2 (Ab-64) Antibody
- BackgroundIntegrated bioinformatics approaches were used to identify stage-specific candidate genes and potential drug targets in triple-negative breast cancer (TNBC).MethodsMicroarray (164 early-stage, 33 advanced-stage, and 53 normal samples) and RNA-seq (113 normal, 163 early-stage, and 30 advanced-stage TNBC samples) datasets were analyzed. Differentially expressed genes (DEGs) were identified, followed by co-expression analysis using Weighted Gene Co-expression Network Analysis (WGCNA) and protein-protein interaction analysis using the STRING database. miRNA co-regulation was evaluated using multiMiR and TCGA correlation analyses. Candidate genes were validated using UALCAN and immunohistochemistry data. Molecular docking assessed potential therapeutic agents.ResultsNovel stage-specific candidate biomarkers were identified, including , , , and in early-stage TNBC, and , , , and in advanced-stage TNBC. UALCAN analysis confirmed the dysregulation of these genes across 23 additional malignancies. STRING-based network analysis revealed stage-specific protein-protein interactions, including SKP2-SKP1 in early-stage and F11R-TJP1 in advanced-stage TNBC. miRNA co-regulation distinguished early-stage TNBC through PI3K-AKT-related pathways and advanced-stage TNBC through tumor progression-associated pathways. Docking-based drug repurposing highlighted conventional agents (e.g., doxorubicin) and potential novel candidates (e.g., sunitinib).ConclusionThis study identifies novel stage-specific gene candidates and suggests repurposable drugs for TNBC, supporting progression-specific targeted therapeutic strategies. - Source: PubMed
Publication date: 2026/05/28
Shahraki FaezeMeshkini AzadehNazari Elham - Aberrant cell cycle progression is a hallmark of non-small cell lung cancer (NSCLC) and remains a major driver of uncontrolled tumor growth. β-Transducin repeat-containing protein 2 (β-TrCP2), a substrate-recognition component of an E3 ubiquitin ligase complex, has been implicated in diverse cellular processes; however, its role in NSCLC progression is not fully understood. This study aimed to investigate the functional significance of β-TrCP2 in NSCLC cell proliferation and cell cycle regulation. - Source: PubMed
Kim NayunKim JinjuNguyen Hai-AnhMun Se HwanHan SoraYang Young - Benzo[a]pyrene (BaP), a polycyclic aromatic hydrocarbon from tobacco smoke, exhaust, and pollutants, is linked to bladder cancer (BLCA). We systematically analyzed GEO datasets to identify BaP-related differentially expressed genes (DEBRGs). By integrating network toxicology, machine learning, molecular docking, molecular dynamics, and single-cell transcriptomics, we identified 19 significant genes, among which 7 key DEBRGs were prioritized (GSK3B, SKP2, AURKB, EPHB4, KIT, NR3C2, and CA2) in BaP-mediated BLCA. SHAP analysis highlighted GSK3B and SKP2 as important genes contributing to the predictive model. Single-cell data revealed their cell-type specific expression in the tumor microenvironment. Molecular simulations detailed interactions between BaP and target proteins. This study identified critical genes in BaP-induced bladder carcinogenesis, offering insights into underlying molecular mechanisms and potential therapeutic targets. - Source: PubMed
Publication date: 2026/05/21
Zhao XinzhaoQin RuizeShen ChengquanHu DingLi ChengLiu ChangxueGe HuaixiWang Yonghua - Cyclin D1 (CCND1) as a regulator of the cell cycle has been implicated in disease progression and prognosis of human malignancies. However, its prognostic significance in cytoplasmic versus nuclear localizations has not been well established in human prostate cancer (PCa). - Source: PubMed
Publication date: 2026/04/27
Ayala AlejandroDing YiBu PingMiles BrianAyala Gustavo - S-phase kinase-associated protein 2 (SKP2) functions as a dual-ubiquitin modulator in breast cancer progression by orchestrating two distinct ubiquitination process. Through Ub-K48-linked degradation, SKP2 facilitates proteasomal turnover of tumor suppressors while Ub-K63-linked modification amplifies oncogenic signaling cascades. Together, these mechanisms drive uncontrolled cell proliferation, enhance metastatic potential, and contribute to therapeutic resistance. To therapeutically intercept SKP2, this study employed a consolidated structural informatics framework to rationally design small interfering RNAs (siRNAs) with high target specificity. Commencing with a curated library of 127 siRNA sequences, a multiparametric filtration cascade of thermodynamic profiling, secondary structure interrogation, and genome-wide off-target exclusion refined the pool of eight high-confidence siRNA candidates. These were further subjected to binding against human Argonaute 2 (hAgo2), a catalytic epicenter of the RNA-induced silencing complex (RISC). Interestingly, siRNA 10 and siRNA 11 emerged as lead candidates, exhibiting robust binding affinities, precise spatial accommodation within the Ago2 binding cleft, and predicted silencing efficiencies of 96.5%. To further assess their dynamic stability and conformational behavior, all-atom molecular dynamics simulations were performed to both bound and unbound siRNA with the Ago2 complex using the CHARMM-GUI interface and CHARMM36m force field, optimized for RNA-protein interactions. We report our designed siRNA 10 (5'AUCACUUAAGUCUAGAUGGAC'3) and siRNA 11 (5'UAUCACUUAAGUCUAGAUGGA'3) for precise silencing of SKP2, offering a targeted therapeutic avenue to disrupt dual-ubiquitin-driven oncogenic progression in breast cancer. - Source: PubMed
Publication date: 2026/04/03
Gupta Manshi KumariSudandiradoss Chinnappan