Ask about this productRelated genes to: IL12 p40 antibody
- Gene:
- IL12RB1 NIH gene
- Name:
- interleukin 12 receptor subunit beta 1
- Previous symbol:
- IL12RB
- Synonyms:
- CD212
- Chromosome:
- 19p13.11
- Locus Type:
- gene with protein product
- Date approved:
- 1995-09-14
- Date modifiied:
- 2019-04-23
Related products to: IL12 p40 antibody
Related articles to: IL12 p40 antibody
- Mendelian susceptibility to mycobacterial disease (MSMD) is a rare syndrome characterized by increased and selective susceptibility to weakly virulent mycobacteria and other intramacrophagic pathogens. This study emphasizes the utility of immunological and functional assays in diagnosing MSMD by analyzing clinical, immunological, and genetic features in 50 Indian patients. Immunological workup included lymphocyte subset analysis, nitroblue tetrazolium test (NBT), and flow cytometric assessment of IFN-γR1 (CD119), IL-12Rβ1 (CD212), and phosphorylated STAT1/STAT4 following cytokine stimulation. Functional assays measured IFN-γ and IL-12p70 production. Genetic evaluation was performed using whole-exome or Sanger sequencing. The median age at onset was 3 mo. BCG complications were the most common presentation (96%), while 4% had non-tuberculous mycobacterial infections. Additional infections included , spp., spp., and multiple types of viruses. IL-12Rβ1 deficiency was the most frequent diagnosis, with 10 novel variants in the gene identified. These results demonstrate that combining flow cytometry with functional and genetic analyses enables accurate and timely MSMD diagnosis. - Source: PubMed
Publication date: 2025/12/18
Dalvi AparnaTemkar LavinaDesai MukeshGarg SwatiAluri JahnaviHule GouriBargir Umair AhmedSetia PriyankaKambli PriyankaDhawale AmrutaTamhankar ParagYadav Reetika MalikBhattad SagarSivasankaran MeenaLashkari Harsha PrasadKacha AsrutiBharathi T KasiKanakia SwatiGandhi Kamana ArunShelar ShraddhaShinde ShwetaJodhawat NehaKawale RameshSalve NitinCasanova Jean-LaurentBustamante JacintaMadkaikar Manisha R - Mendelian susceptibility to mycobacterial disease (MSMD) is characterized by increased susceptibility to infections caused by weakly virulent mycobacteria (such as nontuberculous mycobacteria (NTM) or the Bacillus Calmette–Guérin (BCG) vaccine) in otherwise healthy individuals. In this study, we described a 29-year-old patient with MSMD due to NTM infection identified using metagenomic next-generation sequencing (mNGS) testing. The patient showed a poor response to standard antimycobacterial treatment. Therefore, we performed whole-exome sequencing (WES) and identified three heterozygous variants in IL-12Rβ1 (Ala131Thr, Arg323* and Arg561*). The two deleterious IL-12RB1 variants, Arg323* and Arg561*,were shown to be in trans (paternal and maternal, respectively). Further investigation revealed that two of these variants (Arg323* and Arg561*) could affect the binding between IL-12Rβ1 and IL-12Rβ2, leading to a weakened response of CD4+ T cells to stimulation with IL-12 plus tuberculosis antigen (TbAg), with reduced expression levels of IFN-γ and its downstream target p-STAT4. However, these variants did not affect the CD4+ T-cell response to glucan stimulation, as the three heterozygous variant loci do not interfere with the aggregation of IL-12Rβ1 and IL-23R. This autosomal recessive, partial IL-12Rβ1 deficiency ultimately resulted in the patient developing disseminated NTM infection. In clinical treatment, we combined IFN-γ with standard antimycobacterial therapy. The patient showed only a partial response to therapy. Therefore, as detection techniques continue to advance, it is important for clinicians to increase their understanding of MSMD to enable faster and more accurate diagnosis and treatment. - Source: PubMed
Publication date: 2026/04/21
Chen JinmeiXi MinHu WeiweiHe RongliZhang WenruiZhang YiChen XiaohuaChen Jie - Lung cancer is the leading cause of cancer-related death in the world. Blimp-1 is a transcriptional repressor that, by interacting with other transcription factors in lymphocytes, regulates their cellular fate. - Source: PubMed
Publication date: 2026/04/15
Finotto SusettaChiriac Mircea TKrammer SusanneYang ZuqinNeurath LauraGeppert Carol INendel ElvedinaTrump SonjaGeiger AdrianaWirtz StefanZundler SebastianNeurath Markus F - Although pediatric asthma is closely associated with dysregulated inflammatory cytokines, integrated analyses of inflammatory cytokine-related genes and their potential diagnostic biomarkers remain limited. - Source: PubMed
Publication date: 2026/04/07
Gao Mi MiWang XueYin LiWei Xiao YingLi Fang - BACKGROUND: Mendelian susceptibility to mycobacterial disease (MSMD) is a rare immunodeficiency characterized by increased vulnerability to weakly virulent mycobacteria. However, its clinical and molecular spectrum, as well as its susceptibility to infections beyond mycobacteria, remains incompletely understood. OBJECTIVE: To evaluate the clinical and genetic characteristics of MSMD patients, focusing on their susceptibility to mycobacteria, SARS-CoV-2 and endemic fungal infections. METHODS: Thirteen MSMD patients underwent genetic analyses, immunological assays, and clinical evaluations. COVID-19 outcomes were documented. Pathological findings and mNGS confirmed Talaromyces marneffei infections. RESULTS: Following BCG vaccination, 92.3% (12/13) developed regional or disseminated infections. Additional infections included severe tuberculosis and Mycobacterium avium. All patients experienced SARS-CoV-2 infections and present mild symptoms. One IL12RB1-deficient patient presented with isolated disseminated Talaromyces marneffei infection but otherwise healthy. Another AR IFNGR1-deficient patient with concurrent mycobacterial and fungal infections. Genetic analysis identified five novel mutations (c.155G > C, p.C52S, c. 617 A > C, p.Q206P, c.923 A > G; p.Y308C, c.1282_1301deIACCTTGTGGTCTACGGTCCTinsC; p.T428fs* in IL12RB1 and c.811 A > T, p.K271X in IFNGR1). Functional assays confirmed impaired IL12-IFNγ axis signaling. Patients with partial IFNGR1 defects showed complete clinical remission with higher doses IFN-γ therapy basing on STAT1 phosphorylation dynamics analysis under IFN-γ activation in vitro. CONCLUSION: The patient experienced significant diagnostic delays. Adverse reactions to BCG vaccination, NTM infection or severe mycobacteria tuberculosis infections in other wise healthy children strongly suggest MSMD. MSMD patients are susceptible to SARS-CoV-2 but do not exhibit severe COVID-19. Talaromyces marneffei could be an initial manifestation of MSMD in endemic regions. Early diagnosis and targeted therapy, including IFNγ and anti-tuberculosis treatments, are critical to improving outcomes. - Source: PubMed
Publication date: 2026/04/10
Zhang WenjingZhang ZhenzhenLiu CongYang XiTang WenjingXing ShubinChen RanTang XuemeiZhang ZhiyongDing YuanZhou LinaJia YanjunAn YunfeiZhao Xiaodong