Ask about this productRelated genes to: SKP2 antibody
- Gene:
- SKP2 NIH gene
- Name:
- S-phase kinase associated protein 2
- Previous symbol:
- -
- Synonyms:
- FBXL1, FBL1, p45
- Chromosome:
- 5p13.2
- Locus Type:
- gene with protein product
- Date approved:
- 1995-12-18
- Date modifiied:
- 2016-10-05
Related products to: SKP2 antibody
Related articles to: SKP2 antibody
- Cyclin D1 (CCND1) as a regulator of the cell cycle has been implicated in disease progression and prognosis of human malignancies. However, its prognostic significance in cytoplasmic versus nuclear localizations has not been well established in human prostate cancer (PCa). - Source: PubMed
Publication date: 2026/04/27
Ayala AlejandroDing YiBu PingMiles BrianAyala Gustavo - S-phase kinase-associated protein 2 (SKP2) functions as a dual-ubiquitin modulator in breast cancer progression by orchestrating two distinct ubiquitination process. Through Ub-K48-linked degradation, SKP2 facilitates proteasomal turnover of tumor suppressors while Ub-K63-linked modification amplifies oncogenic signaling cascades. Together, these mechanisms drive uncontrolled cell proliferation, enhance metastatic potential, and contribute to therapeutic resistance. To therapeutically intercept SKP2, this study employed a consolidated structural informatics framework to rationally design small interfering RNAs (siRNAs) with high target specificity. Commencing with a curated library of 127 siRNA sequences, a multiparametric filtration cascade of thermodynamic profiling, secondary structure interrogation, and genome-wide off-target exclusion refined the pool of eight high-confidence siRNA candidates. These were further subjected to binding against human Argonaute 2 (hAgo2), a catalytic epicenter of the RNA-induced silencing complex (RISC). Interestingly, siRNA 10 and siRNA 11 emerged as lead candidates, exhibiting robust binding affinities, precise spatial accommodation within the Ago2 binding cleft, and predicted silencing efficiencies of 96.5%. To further assess their dynamic stability and conformational behavior, all-atom molecular dynamics simulations were performed to both bound and unbound siRNA with the Ago2 complex using the CHARMM-GUI interface and CHARMM36m force field, optimized for RNA-protein interactions. We report our designed siRNA 10 (5'AUCACUUAAGUCUAGAUGGAC'3) and siRNA 11 (5'UAUCACUUAAGUCUAGAUGGA'3) for precise silencing of SKP2, offering a targeted therapeutic avenue to disrupt dual-ubiquitin-driven oncogenic progression in breast cancer. - Source: PubMed
Publication date: 2026/04/03
Gupta Manshi KumariSudandiradoss Chinnappan - The Skp2-Cks1 protein-protein interaction is essential for SCF-mediated recognition and ubiquitination of cell-cycle regulators, making this interface an attractive target for anticancer drug discovery. In this study, we identified new small-molecule Skp2-Cks1 disruptors from a focused [1,2,4]triazolo[1,5-a]pyrimidine library using an integrated computational and experimental workflow. A scaffold-based set of 40 compounds was filtered by diversity, purchasability, and drug-likeness, followed by docking into the Skp2-Cks1 interfacial pocket. Five hits (C1-C5) were prioritized and further evaluated by 1000 ns molecular dynamics simulations, MM/PBSA calculations, free-energy landscape analysis, and in silico ADMET profiling. Docking and simulation results supported stable occupancy of the Skp2-Cks1 hotspot by the selected compounds, with ligand-dependent effects on interfacial stability and conformational sampling. Among the series, C3 showed the clearest computational signature of protein-protein interaction weakening, while C4, C3, and C5 showed the most favorable predicted binding to the Skp2-Cks1 pocket; however, favorable ligand binding was not always accompanied by equivalent weakening of the protein-protein interaction. Free-energy landscape analysis indicated that ligand binding reshaped the conformational ensemble of Skp2-Cks1 toward more defined low-energy states. Experimental validation using an in vitro HTRF assay confirmed dose-dependent inhibition of the Skp2-Cks1 interaction. C3 emerged as the most potent inhibitor (IC = 1.88 ± 0.16 μM), outperforming the reference inhibitor NSC689857 (IC = 2.89 ± 0.35 μM), while C5 also showed strong activity (IC = 5.76 ± 0.68 μM). Overall, this work identifies [1,2,4]triazolo[1,5-a]pyrimidines as promising Skp2-Cks1 inhibitors and establishes C3 as a lead scaffold for further optimization. - Source: PubMed
Publication date: 2026/04/18
Kamel Emadeldin MKhadrawy Sally MostafaAllam Ahmed AOthman Sarah IAlshabrmi Fahad MAlkhayl Faris F AbaLamsabhi Al Mokhtar - Image 1. - Source: PubMed
Publication date: 2025/12/20
Wang YuanshuoLi XiaolanFu JiejunLiu ShoushiHao JieCheng ZhipingHe SonghuaYang XinJin RonghuaLu JinjianLu QinpeiHuang QiujuGuo Hongwei - Osteosarcoma (OS) is an aggressive bone malignancy with poor prognosis, characterized by high metastasis rates. Kinesin family member 18B (), a key protein in cell division and mitosis, has emerged as a potential diagnostic and therapeutic target in various cancers, including OS. This study investigates the role of in OS progression and its underlying mechanisms. We found that expression is significantly upregulated in OS tissues and correlates with lymph node metastasis (N-stage) and clinical stage. Knockdown of inhibited OS cell migration, invasion, proliferation, and tumorigenesis. Mechanistically, promotes OS survival through the ubiquitin-proteasome system (UPS) by regulating Skp2 protein degradation. knockdown accelerated Skp2 ubiquitination, leading to reduced Skp2 levels and inhibited OS cell viability and glycolytic metabolism. Overexpression of enhanced OS cell viability and glycolysis in an Skp2-dependent manner. These findings suggest that the -Skp2 axis plays a critical role in the metabolic reprogramming of OS cells and serves as a novel prognostic biomarker and therapeutic target in OS. - Source: PubMed
Publication date: 2026/04/02
Liu HaonanGuo XinLu ChaoxiangLu Daifeng